This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012979


Marker Name:  MAN2A2 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GTCATGCCACGGAATTATCC
Primer: CGTCACTCTGACACCTCACG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646898

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3b Cat
chromosome D3
176.000 176.000 176.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
1109.300 1109.300 1109.300
Murphy et al 2006: D3 Cat
chromosome D3
1351.200 1351.200 1351.200


© The Roslin Institute 2007-2012, all rights reserved