This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012977


Marker Name:  FCA277 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTCCCTCTCTCTCTGCCCTT
Primer: GAAAACGGCAGAAAAGCAAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130594

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3b Cat
chromosome D3
149.000 149.000 149.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
1187.400 1187.400 1187.400
Menotti-Raymond, Marilyn et al 1999 (A): D3a Cat
chromosome D3
22.000 22.000 22.000
Murphy et al 2006: D3 Cat
chromosome D3
1156.100 1156.100 1156.100


© The Roslin Institute 2007-2012, all rights reserved