This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012974


Marker Name:  FCA603 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TAGCAGCATTATGTGGAAATGG
Primer: CAGCATTAATGCTCTAGCTCCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130672

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3b Cat
chromosome D3
102.000 102.000 102.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
882.300 882.300 882.300
Menotti-Raymond, Marilyn et al 1999 (A): D3a Cat
chromosome D3
62.000 62.000 62.000
Murphy et al 2006: D3 Cat
chromosome D3
940.800 940.800 940.800


© The Roslin Institute 2007-2012, all rights reserved