This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012968


Marker Name:  TYMS 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GGGTGTACCCTTCAACATCG
Primer: AGCTGCAAGGTGAGCAAGTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AZ081274

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3b Cat
chromosome D3
66.000 66.000 66.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
780.700 780.700 780.700
Murphy et al 2006: D3 Cat
chromosome D3
757.600 757.600 757.600


© The Roslin Institute 2007-2012, all rights reserved