This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012964


Marker Name:  FCA026 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GGAGCCCTTAGAGTCATGCA
Primer: TGTACACGCACCAAAAACAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130482

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3b Cat
chromosome D3
40.000 40.000 40.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
583.800 583.800 583.800
Menotti-Raymond, Marilyn et al 1999 (A): D3a Cat
chromosome D3
110.000 110.000 110.000
Murphy et al 2006: D3 Cat
chromosome D3
463.300 463.300 463.300


© The Roslin Institute 2007-2012, all rights reserved