This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012962


Marker Name:  FCA249 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCAGAAAGCTATGATTTGGAGA
Primer: ATCAATACCATTCTTTGCCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130584

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3b Cat
chromosome D3
36.000 36.000 36.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
258.600 258.600 258.600
Menotti-Raymond, Marilyn et al 1999 (A): D3a Cat
chromosome D3
116.000 116.000 116.000
Murphy et al 2006: D3 Cat
chromosome D3
317.300 317.300 317.300


© The Roslin Institute 2007-2012, all rights reserved