This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012961


Marker Name:  FCA200 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTCCCAGCCAGAAAGCTG
Primer: AGCATCTGGTTGGCTCAGTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130562

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3b Cat
chromosome D3
21.000 21.000 21.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
193.800 193.800 193.800
Menotti-Raymond, Marilyn et al 1999 (A): D3a Cat
chromosome D3
135.000 135.000 135.000
Murphy et al 2006: D3 Cat
chromosome D3
251.300 251.300 251.300


© The Roslin Institute 2007-2012, all rights reserved