This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012958


Marker Name:  FCA137 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AGTCCAGAGAACTTCAGATGCC
Primer: ACTGAGCCCAGCCAGGTAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130539

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D3a Cat
chromosome D3
18.000 18.000 18.000
Menotti-Raymond, M et al 2003: D3 Cat
chromosome D3
32.600 32.600 32.600
Menotti-Raymond, Marilyn et al 1999 (A): D3b Cat
chromosome D3
0.000 0.000 0.000
Murphy et al 2006: D3 Cat
chromosome D3
90.200 90.200 90.200


© The Roslin Institute 2007-2012, all rights reserved