This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012953


Marker Name:  FCA366 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GAAGGCCTATTCCACTTCAGG
Primer: TCCCCATCTTGTACTCTCTTGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D2b Cat
chromosome D2
67.000 67.000 67.000
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
876.300 876.300 876.300
Menotti-Raymond, Marilyn et al 1999 (A): D2b Cat
chromosome D2
9.000 9.000 9.000
Murphy et al 2006: D2 Cat
chromosome D2
860.800 860.800 860.800


© The Roslin Institute 2007-2012, all rights reserved