This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012950


Marker Name:  FCA078 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGAACTGAAGTCAGATGCTTAACC
Primer: CGGAATCAGCTATTTTTACGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130507

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D2b Cat
chromosome D2
49.000 49.000 49.000
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
917.100 917.100 917.100
Menotti-Raymond, Marilyn et al 1999 (A): D2b Cat
chromosome D2
16.000 16.000 16.000
Murphy et al 2006: D2 Cat
chromosome D2
754.400 754.400 754.400


© The Roslin Institute 2007-2012, all rights reserved