This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012947


Marker Name:  GHITM 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCAAACATCTGAAACCTGCTG
Primer: GCAACTGGAAGCAACAGAAA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646887

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D2b Cat
chromosome D2
31.000 31.000 31.000
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
488.300 488.300 488.300
Murphy et al 2006: D2 Cat
chromosome D2
563.400 563.400 563.400


© The Roslin Institute 2007-2012, all rights reserved