This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012945


Marker Name:  PLAU 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCAACAAGTACTTCTCCAACATTC
Primer: AGTTCCAGGCCAGGCAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF114703

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D2b Cat
chromosome D2
0.000 0.000 0.000
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
515.900 515.900 515.900
Murphy et al 2006: D2 Cat
chromosome D2
587.200 587.200 587.200


© The Roslin Institute 2007-2012, all rights reserved