This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012941


Marker Name:  FCA462 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCATGAGATGGGAAAAGAGAGA
Primer: GCCATTACTGAAGGTATCAGGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130629

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D2a Cat
chromosome D2
43.000 43.000 43.000
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
159.800 159.800 159.800
Menotti-Raymond, Marilyn et al 1999 (A): D2a Cat
chromosome D2
38.000 38.000 38.000
Murphy et al 2006: D2 Cat
chromosome D2
242.300 242.300 242.300


© The Roslin Institute 2007-2012, all rights reserved