This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012940


Marker Name:  FCA262 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ATCTCTTCCATGGTGTGTGATG
Primer: TACAGAATACTCCCCCCGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130589

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D2a Cat
chromosome D2
31.000 31.000 31.000
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
86.000 86.000 86.000
Menotti-Raymond, Marilyn et al 1999 (A): D2a Cat
chromosome D2
28.000 28.000 28.000
Murphy et al 2006: D2 Cat
chromosome D2
100.200 100.200 100.200


© The Roslin Institute 2007-2012, all rights reserved