This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012939


Marker Name:  LGALS8 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCTCCTAGGTGTTCTGGGTCT
Primer: GCAGTGCTGGCAGGAAATA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646886

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D2a Cat
chromosome D2
25.000 25.000 25.000
Menotti-Raymond, M et al 2003: D2 Cat
chromosome D2
58.800 58.800 58.800
Murphy et al 2006: D2 Cat
chromosome D2
76.000 76.000 76.000


© The Roslin Institute 2007-2012, all rights reserved