This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012937


Marker Name:  HRAS 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: TGAACATCCCAAATGCCAC
Primer: AGCCGAAAACCAAGATCAAG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U62092

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D1d Cat
chromosome D1
6.000 6.000 6.000
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
1432.900 1432.900 1432.900
Murphy et al 2006: D1 Cat
chromosome D1
1394.900 1394.900 1394.900


© The Roslin Institute 2007-2012, all rights reserved