This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012935


Marker Name:  FCA239 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGAAGGTGTGGAGATAAGTGTT
Primer: AGCAAACAAAAAAGATGTCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130579

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D1c Cat
chromosome D1
102.000 102.000 102.000
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
1271.100 1271.100 1271.100
Menotti-Raymond, Marilyn et al 1999 (A): D1a Cat
chromosome D1
0.000 0.000 0.000
Murphy et al 2006: D1 Cat
chromosome D1
1181.000 1181.000 1181.000


© The Roslin Institute 2007-2012, all rights reserved