This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012933


Marker Name:  FCA698 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GGGAAATAACAGGCTAGCAGG
Primer: TCAGGCTTCACACTCACAGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130700

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D1c Cat
chromosome D1
72.000 72.000 72.000
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
1215.400 1215.400 1215.400
Menotti-Raymond, Marilyn et al 1999 (A): D1a Cat
chromosome D1
28.000 28.000 28.000
Murphy et al 2006: D1 Cat
chromosome D1
1124.100 1124.100 1124.100


© The Roslin Institute 2007-2012, all rights reserved