This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012927


Marker Name:  TYR 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GCTTTATGTGATGGAACTCCA
Primer: CAGCTTTATCCATGGAATCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U40716

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D1c Cat
chromosome D1
17.000 17.000 17.000
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
914.000 914.000 914.000
Murphy et al 2006: D1 Cat
chromosome D1
757.400 757.400 757.400


© The Roslin Institute 2007-2012, all rights reserved