This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012926


Marker Name:  FCA341 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCCTTGCAAATGGAAAGAAA
Primer: GCCCAAATATCCATCAATCG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D1c Cat
chromosome D1
10.000 10.000 10.000
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
725.500 725.500 725.500
Menotti-Raymond, Marilyn et al 1999 (A): D1a Cat
chromosome D1
84.000 84.000 84.000
Murphy et al 2006: D1 Cat
chromosome D1
608.700 608.700 608.700


© The Roslin Institute 2007-2012, all rights reserved