This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012925


Marker Name:  FCA144 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GGAAATCCTGGAAACTTCTGC
Primer: CCCGGCAAAATTATGAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130542

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): D1c Cat
chromosome D1
3.000 3.000 3.000
Menotti-Raymond, M et al 2003: D1 Cat
chromosome D1
357.500 357.500 357.500
Menotti-Raymond, Marilyn et al 1999 (A): D1a Cat
chromosome D1
91.000 91.000 91.000
Murphy et al 2006: D1 Cat
chromosome D1
428.300 428.300 428.300


© The Roslin Institute 2007-2012, all rights reserved