This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012919


Marker Name:  FCA117 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AGCTCTTTAACCATGGGAAATG
Primer: CCCTTTTTCAGCATTAGTCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130527

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C2b Cat
chromosome C2
113.000 113.000 113.000
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
1202.500 1202.500 1202.500
Menotti-Raymond, Marilyn et al 1999 (A): C2a Cat
chromosome C2
82.000 82.000 82.000
Murphy et al 2006: C2 Cat
chromosome C2
1332.800 1332.800 1332.800


© The Roslin Institute 2007-2012, all rights reserved