This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012917


Marker Name:  FCA424 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGGAAAAATGTGGAATACTGAA
Primer: CCAATTTGTAGTGACATCCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130625

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C2b Cat
chromosome C2
79.000 79.000 79.000
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
936.600 936.600 936.600
Menotti-Raymond, Marilyn et al 1999 (A): C2a Cat
chromosome C2
48.000 48.000 48.000
Murphy et al 2006: C2 Cat
chromosome C2
1037.400 1037.400 1037.400


© The Roslin Institute 2007-2012, all rights reserved