This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012915


Marker Name:  FCA048 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCCATACATGTTATTGCAGATGG
Primer: GAAAAAACTCTAAGTTGGTATGGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130490

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C2b Cat
chromosome C2
62.000 62.000 62.000
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
427.300 427.300 427.300
Menotti-Raymond, Marilyn et al 1999 (A): C2a Cat
chromosome C2
48.000 76.500 105.000
Murphy et al 2006: C2 Cat
chromosome C2
419.500 419.500 419.500


© The Roslin Institute 2007-2012, all rights reserved