This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012913


Marker Name:  GBE1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CAAGTGTATTGACTTTCTGGTTCTC
Primer: CAGATGCCGTAGGAACCCAAGTC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C2b Cat
chromosome C2
32.000 32.000 32.000
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
299.700 299.700 299.700
Murphy et al 2006: C2 Cat
chromosome C2
309.300 309.300 309.300


© The Roslin Institute 2007-2012, all rights reserved