This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012906


Marker Name:  FCA638 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCCCAGCACTGAATTGATTT
Primer: GTGGAGCCTGCTTGAGATTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130679

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C2a Cat
chromosome C2
30.000 30.000 30.000
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
93.300 93.300 93.300
Menotti-Raymond, Marilyn et al 1999 (A): C2b Cat
chromosome C2
30.000 30.000 30.000
Murphy et al 2006: C2 Cat
chromosome C2
112.000 112.000 112.000


© The Roslin Institute 2007-2012, all rights reserved