This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012905


Marker Name:  FCA346 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GAATGCCTAGGTAGCACTGTCC
Primer: AGAGATGAAGCCCAGAACCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130614

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C2a Cat
chromosome C2
8.000 8.000 8.000
Menotti-Raymond, M et al 2003: C2 Cat
chromosome C2
42.900 42.900 42.900
Menotti-Raymond, Marilyn et al 1999 (A): C2b Cat
chromosome C2
8.000 8.000 8.000


© The Roslin Institute 2007-2012, all rights reserved