This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012901


Marker Name:  FCA364 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GTGTGCCTCTGGCAGGAC
Primer: TGGAGGTGCTCTGTAAAGTGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
199.000 199.000 199.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1813.600 1813.600 1813.600
Menotti-Raymond, Marilyn et al 1999 (A): C1a Cat
chromosome C1
10.000 10.000 10.000
Murphy et al 2006: C1 Cat
chromosome C1
1961.000 1961.000 1961.000


© The Roslin Institute 2007-2012, all rights reserved