This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012900


Marker Name:  FCA649 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: ACTGCCTGCACACTGACTTG
Primer: TTAGTCCTGGTGAGACTTTGTG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130682

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
190.000 190.000 190.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1790.900 1790.900 1790.900
Menotti-Raymond, Marilyn et al 1999 (A): C1a Cat
chromosome C1
20.000 20.000 20.000
Murphy et al 2006: C1 Cat
chromosome C1
1932.900 1932.900 1932.900


© The Roslin Institute 2007-2012, all rights reserved