This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012898


Marker Name:  FN1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GGGCTTGTCTCCATCAGACT
Primer: GGTCTTCCAGCTGCTGACAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646863

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
159.000 159.000 159.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1707.500 1707.500 1707.500
Murphy et al 2006: C1 Cat
chromosome C1
1837.000 1837.000 1837.000


© The Roslin Institute 2007-2012, all rights reserved