This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012894


Marker Name:  FCA573 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TTGACAGAGACAGAGTGCAAGC
Primer: TCTTGCAGTTGGTGAGTTTAGC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130664

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
106.000 106.000 106.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1472.400 1472.400 1472.400
Menotti-Raymond, Marilyn et al 1999 (A): C1a Cat
chromosome C1
85.000 85.000 85.000
Murphy et al 2006: C1 Cat
chromosome C1
1572.500 1572.500 1572.500


© The Roslin Institute 2007-2012, all rights reserved