This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012892


Marker Name:  FCA173 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GGCTAATGGCTACCGTGTGT
Primer: CCCAGGGAACCCATAGAAAT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130554

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
70.000 70.000 70.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1389.300 1389.300 1389.300
Menotti-Raymond, Marilyn et al 1999 (A): C1a Cat
chromosome C1
120.000 120.000 120.000
Murphy et al 2006: C1 Cat
chromosome C1
1505.400 1505.400 1505.400


© The Roslin Institute 2007-2012, all rights reserved