This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012890


Marker Name:  FCA293 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: GATGGCCCAAAAGCACAC
Primer: CCCACATCTTGTCAACAACG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130598

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
56.000 56.000 56.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1219.900 1219.900 1219.900
Menotti-Raymond, Marilyn et al 1999 (A): C1a Cat
chromosome C1
134.000 134.000 134.000
Murphy et al 2006: C1 Cat
chromosome C1
1374.200 1374.200 1374.200


© The Roslin Institute 2007-2012, all rights reserved