This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012889


Marker Name:  FCA343 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTTTCACACATTTGTTCCACA
Primer: AGCCGGACACTCAACTGACT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130612

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
49.000 49.000 49.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
1080.700 1080.700 1080.700
Menotti-Raymond, Marilyn et al 1999 (A): C1a Cat
chromosome C1
141.000 141.000 141.000
Murphy et al 2006: C1 Cat
chromosome C1
1233.500 1233.500 1233.500


© The Roslin Institute 2007-2012, all rights reserved