This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012886


Marker Name:  F37 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CGCCTTTCTCACATTACCAT
Primer: CACTGACAGATCTGATCCTG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): C1b Cat
chromosome C1
4.000 4.000 4.000
Menotti-Raymond, M et al 2003: C1 Cat
chromosome C1
713.900 713.900 713.900
Menotti-Raymond, Marilyn et al 1999 (A): C1a Cat
chromosome C1
183.000 183.000 183.000
Murphy et al 2006: C1 Cat
chromosome C1
807.700 807.700 807.700


© The Roslin Institute 2007-2012, all rights reserved