This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012882


Marker Name:  PDGFB 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: ATGGTTCTGTCCTCCAGGTG
Primer: CTTCTTGTCATGCGTGTGCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF114699

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4e Cat
chromosome B4
129.000 129.000 129.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
1112.200 1112.200 1112.200
Murphy et al 2006: B4 Cat
chromosome B4
1396.700 1396.700 1396.700


© The Roslin Institute 2007-2012, all rights reserved