This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012881


Marker Name:  Fc.40342 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GTCCAGAGTCCCAAGGTGTG
Primer: CCACCCTCTTCCTACCCTACC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AW646842

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4e Cat
chromosome B4
113.000 113.000 113.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
1104.600 1104.600 1104.600
Murphy et al 2006: B4 Cat
chromosome B4
1394.300 1394.300 1394.300


© The Roslin Institute 2007-2012, all rights reserved