This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012877


Marker Name:  PAH 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CTGTGGAGTTTGGGCTTTGC
Primer: AGTCCTCACTTTCTCCTTGGCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF114700

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4e Cat
chromosome B4
79.000 79.000 79.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
1088.900 1088.900 1088.900


© The Roslin Institute 2007-2012, all rights reserved