This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012876


Marker Name:  FCA210 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AGAAGCATCCAGTGACAATGG
Primer: TGAGCCACCTAGGCACTCTT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130566

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4e Cat
chromosome B4
63.000 63.000 63.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
1045.900 1045.900 1045.900
Menotti-Raymond, Marilyn et al 1999 (A): B4b Cat
chromosome B4
61.000 61.000 61.000
Murphy et al 2006: B4 Cat
chromosome B4
1268.400 1268.400 1268.400


© The Roslin Institute 2007-2012, all rights reserved