This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012873


Marker Name:  FCA044 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AGGGCCTGAACCAAGAGAAT
Primer: TATTTACAGAGTGCACAGAGGAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130488

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4e Cat
chromosome B4
42.000 42.000 42.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
956.300 956.300 956.300
Menotti-Raymond, Marilyn et al 1999 (A): B4b Cat
chromosome B4
41.000 41.000 41.000
Murphy et al 2006: B4 Cat
chromosome B4
1140.400 1140.400 1140.400


© The Roslin Institute 2007-2012, all rights reserved