This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012868


Marker Name:  FCA016 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TGTCTTGGGCTTCTTTTTGG
Primer: GCTTGTTTGAAAAGAAATCACA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130479

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4d Cat
chromosome B4
2.000 2.000 2.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
589.200 589.200 589.200
Menotti-Raymond, Marilyn et al 1999 (A): B4a Cat
chromosome B4
12.000 12.000 12.000
Murphy et al 2006: B4 Cat
chromosome B4
626.800 626.800 626.800


© The Roslin Institute 2007-2012, all rights reserved