This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012862


Marker Name:  FCA356 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CTTAACAAGGGACATGGAAAGC
Primer: TCAATTTCATTGCACAATCCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130612

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4b Cat
chromosome B4
0.000 0.000 0.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
405.400 405.400 405.400
Menotti-Raymond, Marilyn et al 1999 (A): B4d Cat
chromosome B4
0.000 0.000 0.000
Murphy et al 2006: B4 Cat
chromosome B4
436.400 436.400 436.400


© The Roslin Institute 2007-2012, all rights reserved