This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012861


Marker Name:  Fc.112998 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GCCTTAAGCGAACACGTCAT
Primer: CTCCTGGCACCAAACCTTC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B4a Cat
chromosome B4
17.000 17.000 17.000
Menotti-Raymond, M et al 2003: B4 Cat
chromosome B4
157.900 157.900 157.900


© The Roslin Institute 2007-2012, all rights reserved