This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012857


Marker Name:  FCA592 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCCTGCAGAAAGCGAGATTT
Primer: TCACCAGAAGAGGGTATGTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130669

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B3b Cat
chromosome B3
112.000 112.000 112.000
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
1151.500 1151.500 1151.500
Menotti-Raymond, Marilyn et al 1999 (A): B3a Cat
chromosome B3
0.000 0.000 0.000
Murphy et al 2006: B3 Cat
chromosome B3
1082.500 1082.500 1082.500


© The Roslin Institute 2007-2012, all rights reserved