This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012856


Marker Name:  FCA230 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: AAGAATGGACTTGGGAAATGG
Primer: AAACCACAACAGGCAAAAGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130577

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B3b Cat
chromosome B3
85.000 85.000 85.000
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
918.000 918.000 918.000
Menotti-Raymond, Marilyn et al 1999 (A): B3a Cat
chromosome B3
24.000 24.000 24.000
Murphy et al 2006: B3 Cat
chromosome B3
980.500 980.500 980.500


© The Roslin Institute 2007-2012, all rights reserved