This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012855


Marker Name:  MYH7 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CATCCAAAGGGGCTGCTAT
Primer: CTTCTTGATCTGCCCAGTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U51472

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B3b Cat
chromosome B3
68.000 68.000 68.000
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
743.300 743.300 743.300
Murphy et al 2006: B3 Cat
chromosome B3
821.900 821.900 821.900


© The Roslin Institute 2007-2012, all rights reserved