This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012852


Marker Name:  CYP19 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: CCCAAGCCCAATGAATTTAC
Primer: TAGGGGAAACGTGTGCTTCT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AZ081261

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B3b Cat
chromosome B3
35.000 35.000 35.000
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
600.300 600.300 600.300
Murphy et al 2006: B3 Cat
chromosome B3
630.100 630.100 630.100


© The Roslin Institute 2007-2012, all rights reserved