This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012851


Marker Name:  FCA201 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: TCTGCAGGACCAGTCAGATG
Primer: AGCATACACAAATTGATGCTGG
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130563

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B3b Cat
chromosome B3
10.000 10.000 10.000
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
554.200 554.200 554.200
Menotti-Raymond, Marilyn et al 1999 (A): B3a Cat
chromosome B3
69.000 69.000 69.000
Murphy et al 2006: B3 Cat
chromosome B3
552.900 552.900 552.900


© The Roslin Institute 2007-2012, all rights reserved