This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012848


Marker Name:  FCA205 
Species:  Cat
Marker Type:  Microsatellite
Publication ID: 12692169

PCR Primers

Primer: CCTGCTCTCAAGGAGCTCC
Primer: CCCATTTCTCCTACCAGTTCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: AF130564

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B3a Cat
chromosome B3
15.000 15.000 15.000
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
451.000 451.000 451.000
Menotti-Raymond, Marilyn et al 1999 (A): B3b Cat
chromosome B3
2.000 2.000 2.000
Murphy et al 2006: B3 Cat
chromosome B3
436.800 436.800 436.800


© The Roslin Institute 2007-2012, all rights reserved