This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00012847


Marker Name:  CYP1A1 
Species:  Cat
Marker Type:  PCR-STS
Publication ID: 12692169

PCR Primers

Primer: GTCCCCAAAGGCCTGAAG
Primer: AAGGACATGCTTTGGCCCTC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: U82184

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Menotti-Raymond, M et al 2003 (A): B3a Cat
chromosome B3
6.000 6.000 6.000
Menotti-Raymond, M et al 2003: B3 Cat
chromosome B3
375.400 375.400 375.400
Murphy et al 2006: B3 Cat
chromosome B3
396.400 396.400 396.400


© The Roslin Institute 2007-2012, all rights reserved